| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.036009 |
| Chromosome: | chromosome 6 |
| Location: | 961474 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256450 | PF6-IP2,FAP119,C1a-34 | Flagellar central-pair associated Protein 119; (1 of 2) PF14769 - Flagellar C1a complex subunit C1a-32 (CLAMP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACCGGGTAAGGAGTCTGAGCGAGAGGCTGCCTTACTGTTGATGACAT |
| Internal bar code: | GTGGTATCGCGTCTTGTTCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2810 |
| LEAP-Seq percent confirming: | 60.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGAACTAGCGCGACATTG |
| Suggested primer 2: | TAAGCAGGCACAGGAATGGG |