| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.036050 |
| Chromosome: | chromosome 5 |
| Location: | 1522933 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234660 | (1 of 4) IPR011016//IPR013083 - Zinc finger, RING-CH-type // Zinc finger, RING/FYVE/PHD-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCATTGAACCTGAAAAGCGCGCTAACGACGCCGCCCTGCCCGGCGCG |
| Internal bar code: | TATGGTAATATTTACCAAGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3347 |
| LEAP-Seq percent confirming: | 98.0392 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATCAATGCCAAATCCCGC |
| Suggested primer 2: | AAATGGCGGGAATCTGAGCA |