| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.036089 |
| Chromosome: | chromosome 12 |
| Location: | 742396 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g492650 | FAS2 | (1 of 10) PTHR10900 - PERIOSTIN-RELATED; Fasciclin-like protein 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAGCCGCCCAACCCCTGGCATGCTGACGCCCCCTTCCGTACATCTGCT |
| Internal bar code: | AGTCACCACAACTGGGTTCAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1954 |
| LEAP-Seq percent confirming: | 61.5385 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTCACCAGGTGCACAAAG |
| Suggested primer 2: | CTGCGTATACGTCCTTCCCC |