| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.036158 |
| Chromosome: | chromosome 17 |
| Location: | 2063253 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g711200 | PGM16 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein; (1 of 1) PTHR18901//PTHR18901:SF2 - 2-DEOXYGLUCOSE-6-PHOSPHATE PHOSPHATASE 2 // GLYCEROL-1-PHOSPHATE PHOSPHOHYDROLASE 1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGAGATTAACGGGACATCGGCACCCCGCGATCAAACATCGCCGCGCG |
| Internal bar code: | TAGGCAAAAGTACATTGTGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2031 |
| LEAP-Seq percent confirming: | 90.0 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTTACCAGTGGCTGCATG |
| Suggested primer 2: | GTGTAGGGGAGGTGGAGGAT |