Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.036162 |
Chromosome: | chromosome 4 |
Location: | 2466474 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g221900 | (1 of 9) IPR000210//IPR011042//IPR011333 - BTB/POZ domain // Six-bladed beta-propeller, TolB-like // POZ domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAGGCGAGCAGACGTGCGAACACATCCGGATCCGCCTCCCGTAGCTCC |
Internal bar code: | ATCGTGTTAAGGTTCTAGCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1798 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGAGCAATAACGACGTCAC |
Suggested primer 2: | CCAGTAAACTCCGTCCCCAC |