| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.036193 |
| Chromosome: | chromosome 3 |
| Location: | 6128575 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g800355 | (1 of 3) PF03732//PF13650 - Retrotransposon gag protein (Retrotrans_gag) // Aspartyl protease (Asp_protease_2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAGAGCAACTGACGCCGACTTGCGCAGGCCGCGGACGTAGGCTCGCA |
| Internal bar code: | CAATCTATAATTGAGGATGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5203 |
| LEAP-Seq percent confirming: | 24.4898 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | 98 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTGTTGTGTGTGACAGCT |
| Suggested primer 2: | CACATCATGTTCAGCTCGCG |