| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.036218 |
| Chromosome: | chromosome 16 |
| Location: | 1151568 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g650151 | SPAST1 | (1 of 2) PF05496//PF09336 - Holliday junction DNA helicase ruvB N-terminus (RuvB_N) // Vps4 C terminal oligomerisation domain (Vps4_C); Spastin homologue | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGTGAAAGCTTAGCGGGGGTGAACGCGCTGGTTGCGGTGAGGAGGCGG |
| Internal bar code: | TTACAGTGTTTACTTAGGACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1020 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAACTTTGGGCACTCACAG |
| Suggested primer 2: | AGAGGAGCCTCCACAAATGC |