| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.036278 |
| Chromosome: | chromosome 9 |
| Location: | 5086721 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g406200 | PRORS1,TSO1 | organellar class II (G, H%252C P and S) tRNA synthetase; (1 of 1) PTHR11451//PTHR11451:SF6 - TRNA SYNTHETASE-RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCAAGGATGTTTGGAATAGCGGTACAGGATGCACTGAAGACTGCAGAC |
| Internal bar code: | GTCCTCGGAATCACGCGATATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 520 |
| LEAP-Seq percent confirming: | 62.2642 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCTCTTTCCGTCACCGTG |
| Suggested primer 2: | CAACCGTACACCCAACCGTA |