| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.036284 |
| Chromosome: | chromosome 7 |
| Location: | 6471001 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g800879 | (1 of 1) IPR000477//IPR002035 - Reverse transcriptase domain // von Willebrand factor, type A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCAGCCTCAGCTGGACTGGGCAACCAAAGCAGTGGACGCTCAACGGCG |
| Internal bar code: | TAACCTTTCCTGTTTTATCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3492 |
| LEAP-Seq percent confirming: | 13.5135 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATAGATGCGCTGCAAGTCG |
| Suggested primer 2: | GAACAGACAGCCTTCCTCCC |