| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.036347 |
| Chromosome: | chromosome 9 |
| Location: | 6346746 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414350 | (1 of 3) PF04824//PF04825 - Conserved region of Rad21 / Rec8 like protein (Rad21_Rec8) // N terminus of Rad21 / Rec8 like protein (Rad21_Rec8_N) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTGGGAGCCGTTTGTGGGCTGAGGCGCCATGTACCCCACTGCGTATGG |
| Internal bar code: | CCACCGCGGAAATTATTGAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4942 |
| LEAP-Seq percent confirming: | 95.3488 |
| LEAP-Seq n confirming: | 82 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGAGCTCAGGCCTGACTA |
| Suggested primer 2: | TACCTCAGTCCCTCCAGCTC |