| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.036411 |
| Chromosome: | chromosome 5 |
| Location: | 2973823 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g230804 | SNF2 | SNF2-related ATPase; (1 of 2) PTHR10799:SF573 - TRANSCRIPTION TERMINATION FACTOR 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCTCGCGAAGCCGCACCTACGCACACTCCACGGCCCCCACACCACCA |
| Internal bar code: | TGTGCTGGGTTTATGCGCCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 301 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGCGCACATCATCTACGAA |
| Suggested primer 2: | TCCCGTGCACTCATTCACTC |