Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.036451 |
Chromosome: | chromosome 5 |
Location: | 2332204 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g238290 | DRP7 | (1 of 1) PF00350//PF01031//PF02212 - Dynamin family (Dynamin_N) // Dynamin central region (Dynamin_M) // Dynamin GTPase effector domain (GED); Dynamin-related GTPase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACACACACACACACACATACACACACCACGCACACTTATCTACTCCG |
Internal bar code: | ATTAATGGAAGGGGCCCAACCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1537 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACAACTTGGAGTCCACCGC |
Suggested primer 2: | ACAGCAAGTACCAGGTCAGC |