| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.036514 |
| Chromosome: | chromosome 16 |
| Location: | 6551510 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g674300 | FAP269 | Ankyrin Repeat Flagellar Associated Protein 269; (1 of 1) PTHR24193:SF61 - ANKYRIN REPEAT DOMAIN-CONTAINING PROTEIN 66 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTATGCCAGCCTGTCTCTGTAGTCAGCCCACCGCGGGCGCACCTTGGC |
| Internal bar code: | TTCACTGTATTGGTTGTTTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2631 |
| LEAP-Seq percent confirming: | 96.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATGGTCGCTCGACATCTC |
| Suggested primer 2: | GGATTTGCTGTGGGGCTAGT |