| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.036566 |
| Chromosome: | chromosome 12 |
| Location: | 2213103 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g508900 | MAPK6 | (1 of 3) K04371 - mitogen-activated protein kinase 1/3 (MAPK1_3); Mitogen-Activated Protein Kinase 6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACTGCTAGCGCCAGACAGCACTTTTGTACATTAGAGGCATGTTTGTT |
| Internal bar code: | TTTTTACCGGTAGAAGTAAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1435 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTGAGGTTTCTCCCCAG |
| Suggested primer 2: | ACAACGTCCATGCGTACCTT |