| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.036649 |
| Chromosome: | chromosome 13 |
| Location: | 3724823 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g801564 | (1 of 3) 1.14.13.39 - Nitric-oxide synthase (NADPH) / NO synthase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGTGGGTGGGCATGGAAGTTTCGTGGGTGGGCATGGAAGTTTCGTGGG |
| Internal bar code: | CATCCGATAGTGTACATGCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 830 |
| LEAP-Seq percent confirming: | 55.8824 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGCCAAAGTCACACTCCT |
| Suggested primer 2: | GCACCTACACCAAGAACGGA |