| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.036656 |
| Chromosome: | chromosome 3 |
| Location: | 1260834 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g149851 | (1 of 15) IPR011991 - Winged helix-turn-helix DNA-binding domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGCGCCGTCCTCCGCCTCGGCCTGCGCCCGCTCCTCCACCGTGAGCG |
| Internal bar code: | TAGACGTCGGGGGCTAGGGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4166 |
| LEAP-Seq percent confirming: | 89.2473 |
| LEAP-Seq n confirming: | 83 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 93 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGTAAGTGCTGTGGACCC |
| Suggested primer 2: | CCATCACCACCTACACCACC |