Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.036659 |
Chromosome: | chromosome 10 |
Location: | 845102 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g801109 | (1 of 9) IPR011011//IPR013083 - Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAACGCCAGTAGCACATCAAGGGCGAGGGAAGCTTCTGCGCACAAGGA |
Internal bar code: | TAAAGAGGCTTCCGATCTGTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2933 |
LEAP-Seq percent confirming: | 2.63158 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCTCTTCTCCCTCGTCCTC |
Suggested primer 2: | AGATGGACATATCGCTGCCG |