| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.036666 |
| Chromosome: | chromosome 3 |
| Location: | 5128483 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g180750 | MES1,METE1,METE,MEtH | (1 of 1) 2.1.1.14 - 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase / Tetrahydropteroylglutamate-homocysteine transmethylase; Cobalamin-dependent methionine synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTACCGAACCTTGGGTGGGGATTAGTGTCCACACGATCCCAAGGGTGC |
| Internal bar code: | TATGTCTCATGATTTGTTTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1861 |
| LEAP-Seq percent confirming: | 64.7059 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGCTAGATGTGGGCTGT |
| Suggested primer 2: | GTGTTCCCGTGTTTCCTTGC |