| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.036702 |
| Chromosome: | chromosome 7 |
| Location: | 326677 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g314400 | (1 of 1) PF00580//PF13538 - UvrD/REP helicase N-terminal domain (UvrD-helicase) // UvrD-like helicase C-terminal domain (UvrD_C_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGACATGACACGACACGACCCAGACAGTCTGACAATCTGTGTGCCCG |
| Internal bar code: | TAGCTACTAGTAGCGATAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 129 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGATCTCAAAATGCGGCTG |
| Suggested primer 2: | GCAACACGAATGCACACACT |