Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.036713 |
Chromosome: | chromosome 10 |
Location: | 3406252 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g444000 | (1 of 2) IPR007743//IPR027417//IPR030385 - Immunity-related GTPases-like // P-loop containing nucleoside triphosphate hydrolase // IRG-type guanine nucleotide-binding (G) domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCAACGAAGGCGATGTTATACTTCTCCGACTCGAAGTGAGGCAGCCGC |
Internal bar code: | TGAGGCTTCGTATATAATATTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1359 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGTTCGCATGAGAGCAGTT |
Suggested primer 2: | ACGGACTTGACCACATGCAT |