Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.036724 |
Chromosome: | chromosome 6 |
Location: | 7348650 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g299850 | HLM10 | (1 of 2) K11426 - SET and MYND domain-containing protein (SMYD); Histone-lysine N-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACGCCGCGTGTGCCCACCTGCCTCTGGCGACTGCGTGTGTCGCAATGC |
Internal bar code: | GCAGGGGTCTCCACTTTTCAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2467 |
LEAP-Seq percent confirming: | 96.6102 |
LEAP-Seq n confirming: | 57 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGTGCCTGACTACAACGCT |
Suggested primer 2: | ACACTGTACATGAGCGCACA |