| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.036777 |
| Chromosome: | chromosome 3 |
| Location: | 7731366 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203500 | Protein tyrosine kinase; (1 of 107) PF00069//PF07714 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCATCCACGGTACTCATCTTGCGCTACTCTTCTTCTTGTACTGCACTG |
| Internal bar code: | CCGTATTCCAAGACACGTACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5066 |
| LEAP-Seq percent confirming: | 97.8102 |
| LEAP-Seq n confirming: | 134 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 137 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTACACAACTGCCTGTCT |
| Suggested primer 2: | CTTCATACGCCGAAAGCACG |