| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.036796 |
| Chromosome: | chromosome 16 |
| Location: | 3145610 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g665100 | CAV3 | Voltage-gated Ca2+ channel, alpha subunit; (1 of 1) IPR000048//IPR005821 - IQ motif, EF-hand binding site // Ion transport domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCCGGGCGCGGCTAGTGACCCGTTGCTGGCAGCTGCCCGCACCCAGTT |
| Internal bar code: | CTTCGGGGCTGAGGCTCGCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 347 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGCCGATTTCGTTCCTC |
| Suggested primer 2: | CAAGCACTGGTTGACTGCAC |