| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.036819 |
| Chromosome: | chromosome 12 |
| Location: | 8282234 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g551352 | LAO1 | Periplasmic L-amino acid oxidase, catalytic subunit; (1 of 1) 1.4.3.2 - L-amino-acid oxidase / Ophio-amino-acid oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCTCATGCATGCCGCCCCGTTTCCGTTTGCTCACCCCCCCACTACCCC |
| Internal bar code: | ATTTTGATTTTCGGTGCCATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 981 |
| LEAP-Seq percent confirming: | 37.5 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCTCAACCTGGGGATGGG |
| Suggested primer 2: | CTGCTGCAGGTCGGAAACTA |