Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.036844 |
Chromosome: | chromosome 14 |
Location: | 2638817 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g625400 | RPT1 | (1 of 1) K03061 - 26S proteasome regulatory subunit T1 (PSMC2, RPT1); 26S proteasome regulatory subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCCACAATGCTTTGCTGCGGCACCTAGCGCGCGCGTGTGCCCTAACA |
Internal bar code: | TCACTGGAACAACTGGGAATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 483 |
LEAP-Seq percent confirming: | 5.55556 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGCGTCTCCTCAACCTGT |
Suggested primer 2: | ATCTGCTTGTCCGACACCAG |