| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.036902 |
| Chromosome: | chromosome 15 |
| Location: | 952632 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g639700 | NCL10,RAP25,OPR93 | Nuclear Control of chloroplast Like 10; (1 of 19) PTHR21228//PTHR21228:SF20 - FAST LEU-RICH DOMAIN-CONTAINING // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACCGCTGCCGACACCGGCCCCAGCTCACCGCGCGCTGCCGCCGCTACT |
| Internal bar code: | AACTATCGCTGGAGGCCGTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2140 |
| LEAP-Seq percent confirming: | 72.4138 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTATGAGCTGAGCCTCC |
| Suggested primer 2: | ATGCAGAATGGTTGGGGAGG |