| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.036948 |
| Chromosome: | chromosome 1 |
| Location: | 7002718 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g050000 | (1 of 1) PTHR31204//PTHR31204:SF1 - FAMILY NOT NAMED // TRANSMEMBRANE PROTEIN 97 | intron | |
| Cre01.g050050 | GUM1 | Putative guanidinoacetate N-methyltransferase; (1 of 1) 2.1.1.2 - Guanidinoacetate N-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTCCAATAGCAAACCGCCAACTGACAGCCAACTGACAGGGGAAACAA |
| Internal bar code: | AGTGTGAGGTATAAGTTAGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1626 |
| LEAP-Seq percent confirming: | 88.5714 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTTCAGCCCTGCAAAGGA |
| Suggested primer 2: | TTAACGACCTGCTGCTGGAG |