| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.036953 |
| Chromosome: | chromosome 6 |
| Location: | 2721853 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g270900 | SUV3 | Mitochondrial DEAD-box DNA/RNA helicase; (1 of 1) K17675 - ATP-dependent RNA helicase SUPV3L1/SUV3 [EC:3.6.4.13] (SUPV3L1, SUV3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGGCCTGAACCTCAACATCCGGCGTGTGGTGTTCTCGTCGCTGCACAA |
| Internal bar code: | GGTATTACGTGTTGCACAGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1353 |
| LEAP-Seq percent confirming: | 58.6207 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGACAGGACTGAGGAGGC |
| Suggested primer 2: | ACACGGTGTACTGTTGTGCA |