Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.037122 |
Chromosome: | chromosome 6 |
Location: | 1452153 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g260150 | SMM17,FAP393 | Flagellar Associated Protein 393; (1 of 1) PTHR12176//PTHR12176:SF16 - UNCHARACTERIZED // PROTEIN C17E4.11 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCTCGCCTCCCCACCAACCCTGCGCCCGCTCTCTGCACCCGCCCTCCT |
Internal bar code: | TTGCCATACCTTGCAGAAAAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3203 |
LEAP-Seq percent confirming: | 72.7273 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACCCTCCACATCAATGCA |
Suggested primer 2: | AGATGCCCTTGTACTTGCCC |