Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.037128 |
Chromosome: | chromosome 11 |
Location: | 3768444 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g479250 | RANGAP1 | RAN GTPase-activating protein 1; (1 of 1) K14319 - Ran GTPase-activating protein 1 (RANGAP1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGTACCGTACGTGAACCCCCCTGTCCCTGCCATCACGTCCTTCCCCT |
Internal bar code: | CCCACCTTATTTATCCACCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 137 |
LEAP-Seq percent confirming: | 75.0 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGGGTACAACAAGATGCCT |
Suggested primer 2: | CTCAATATGCCATGCGCCAC |