Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.037137 |
Chromosome: | chromosome 8 |
Location: | 1982495 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g368400 | TR1,NTR1,TR | (1 of 1) PTHR22912//PTHR22912:SF23 - DISULFIDE OXIDOREDUCTASE // THIOREDOXIN REDUCTASE 1; NADPH-dependent thioredoxin reductase 1, selenoprotein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGAATCCGAGGCTCGCCTGCCGTACTGTGCCCCACCCCCACGCCTCTC |
Internal bar code: | GTAAGTCGACTTAGTGCATACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3874 |
LEAP-Seq percent confirming: | 90.9747 |
LEAP-Seq n confirming: | 252 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 277 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAACCGTTGTTGCAAGCAGC |
Suggested primer 2: | CCCCATGGAAGGAGTGTGTC |