| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.037137 |
| Chromosome: | chromosome 8 |
| Location: | 1982497 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g368400 | TR1,NTR1,TR | (1 of 1) PTHR22912//PTHR22912:SF23 - DISULFIDE OXIDOREDUCTASE // THIOREDOXIN REDUCTASE 1; NADPH-dependent thioredoxin reductase 1, selenoprotein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTAAGCGCAAAGTCCACCAAGTGCCATAGGCACTAACACCAAGGGCAG |
| Internal bar code: | GTCGTATGTGGTGCGCTGACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1885 |
| LEAP-Seq percent confirming: | 98.8372 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCATGGAAGGAGTGTGTC |
| Suggested primer 2: | TAACCGTTGTTGCAAGCAGC |