| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.037154 |
| Chromosome: | chromosome 12 |
| Location: | 5902639 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533600 | DESI6,DeSI-6 | (1 of 6) PF05903 - PPPDE putative peptidase domain (Peptidase_C97); DeSI-type SUMO protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCGCGGGCCCTCAGACTCCCGCCCACCCACGCGTCTGCGTCCCTAGG |
| Internal bar code: | GAAGCGTTTTTTCGTAATAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 54 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACTGTGGCCCTGAATGGA |
| Suggested primer 2: | GCGAATCGTTACAACTCGCC |