| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.037163 |
| Chromosome: | chromosome 7 |
| Location: | 5942095 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354350 | CYP743B1,CYP20 | Cytochrome P450, CYP197 superfamily; (1 of 2) K07424 - cytochrome P450, family 3, subfamily A (CYP3A) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACACATCCGCTCGCGGCCACACGGCGGGGTCGCGGTGCGCAATGTACAT |
| Internal bar code: | GTGAGCTTCGGCTGTATTGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4176 |
| LEAP-Seq percent confirming: | 37.931 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTTTGACGTTCGGTTGTT |
| Suggested primer 2: | CTTGTAGCCGATGCACATGC |