Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.037181 |
Chromosome: | chromosome 1 |
Location: | 2242699 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g012500 | PRA1 | (1 of 2) PF03208 - PRA1 family protein (PRA1); Similar to Prenylated Rab Acceptor Protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAGGTCAACTACTTGATCGTCATGTTGCTCTGCACGGCGTTCACGTT |
Internal bar code: | GACAGACCCTGGTTGTTGCTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2375 |
LEAP-Seq percent confirming: | 86.8421 |
LEAP-Seq n confirming: | 33 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGAAAACGGTGCCCACAC |
Suggested primer 2: | CAGCTTACATAGGCGCGGTA |