| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.037288 |
| Chromosome: | chromosome 5 |
| Location: | 984266 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247100 | COPT1,COTH1 | spore coat protein H; (1 of 3) PF08757 - CotH protein (CotH) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCACCGCGACCCAGCCATCACGCCGTTCTCGGGAACCCCTCGTGTCGT |
| Internal bar code: | GTCATAACAGTATGGCGTTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2927 |
| LEAP-Seq percent confirming: | 93.0556 |
| LEAP-Seq n confirming: | 67 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATGACGCACGTTTCCTGT |
| Suggested primer 2: | GTCTCCTGCTGGAACCCTTC |