| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.037447 |
| Chromosome: | chromosome 9 |
| Location: | 1577157 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399000 | SDR18 | Short-chain dehydrogenase/reductase; (1 of 5) IPR002198//IPR002347//IPR003560//IPR013968 - Short-chain dehydrogenase/reductase SDR // Glucose/ribitol dehydrogenase // 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase // Polyketide synthase, ketoreductase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTTGTTTTGCGGTATCTGGACCTCAAGTCCGGCTGCTCTCCTTCCCC |
| Internal bar code: | GAACAATTAGAGCGTGCTTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2422 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 65 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTCAGCAACGGTTCTAGC |
| Suggested primer 2: | GTTGCAGGAAAGCACTTGGG |