| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.037501 |
| Chromosome: | chromosome 10 |
| Location: | 4796558 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g453000 | (1 of 2) PF11371 - Protein of unknown function (DUF3172) (DUF3172) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTAAACGATCCATTCCTGCCCCCATCTACACCACCGCTCCACCAGTCTC |
| Internal bar code: | AGTGCGCAACACCAACTGGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 352 |
| LEAP-Seq percent confirming: | 65.2174 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCCATAAGAACAACCGCC |
| Suggested primer 2: | CGCTTACACTCGCTGCATTC |