| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.037629 |
| Chromosome: | chromosome 9 |
| Location: | 662681 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404750 | SRR2 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 20) IPR001190//IPR017448 - SRCR domain // SRCR-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACATAACCCGTTTTGCCAGGGGTGCGGACTGCCCACGACCATATCCCCT |
| Internal bar code: | ATGAGTCTAGTTGAGCACAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2613 |
| LEAP-Seq percent confirming: | 78.125 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGCAGCATTACTAACGCG |
| Suggested primer 2: | GCGGATTCAGGTTTGCAAGG |