Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.037631 |
Chromosome: | chromosome 3 |
Location: | 1970916 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g155550 | DNJ18 | (1 of 1) IPR001623//IPR012336 - DnaJ domain // Thioredoxin-like fold; DnaJ-like protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGATGGAGCAACCCCGGCAGCAGCAACAGCAGCAGCACCACGCCCCGCA |
Internal bar code: | AGACTATAGATATGCGCTGACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4431 |
LEAP-Seq percent confirming: | 94.8276 |
LEAP-Seq n confirming: | 55 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGATGGGTCATTATCCGCC |
Suggested primer 2: | CGGCATACTTGACCGCATTG |