Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.037699 |
Chromosome: | chromosome 16 |
Location: | 178353 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g695050 | ECH3,HCD1 | (1 of 1) 1.1.1.35//4.2.1.17//5.1.2.3//5.3.3.8 - 3-hydroxyacyl-CoA dehydrogenase / Beta-keto-reductase // Enoyl-CoA hydratase / Unsaturated acyl-CoA hydratase // 3-hydroxybutyryl-CoA epimerase // Dodecenoyl-CoA isomerase / Dodecenoyl-CoA Delta-isomerase; Enoyl-CoA hydratase 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCAACACTCACGCAGCGGATGCAGCGCGTTCAGCGGCGGGTAGTTGAG |
Internal bar code: | AGTTGAGGTAAGGGTCCATAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 758 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTCGACCCGTAAACTTGGT |
Suggested primer 2: | AAGCAAGACGGGGATCACAG |