Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.037715 |
Chromosome: | chromosome 12 |
Location: | 3358926 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g498350 | RBM25,SRE1,SRS7 | Pre-mRNA splicing factor, SR-related; (1 of 1) K13168 - splicing factor, arginine/serine-rich 16 (SFRS16) | intron |
Cre12.g498400 | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACATTGCCAAAACGCGCCCCCTTCCTGACCATTTCTTCTCAATAGGCAC |
Internal bar code: | GCGGGTTGATGGGTCCGATGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4038 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 52 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAGAAGTCGTTCAGGCCAA |
Suggested primer 2: | TACAGCACGATTGACCGCTT |