| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.037729 |
| Chromosome: | chromosome 7 |
| Location: | 1716441 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325715 | (1 of 29) PF13637 - Ankyrin repeats (many copies) (Ank_4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACACGCGGCCCATGCAACAACACAGAGTCCAGGGCCGCAGCTCACCG |
| Internal bar code: | CCTATTGTGGATCATTGAAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4043 |
| LEAP-Seq percent confirming: | 99.1071 |
| LEAP-Seq n confirming: | 111 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 112 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCAGTTCCGGAAGAAGGG |
| Suggested primer 2: | GATCACATGGGGCGAGGTAG |