Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.037841 |
Chromosome: | chromosome 17 |
Location: | 4333850 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g730250 | PIT,PIT1 | (1 of 1) PTHR12175//PTHR12175:SF2 - AD039 HT014 THIOREDOXIN FAMILY TRP26 // SUBFAMILY NOT NAMED; Proteasome-interacting thioredoxin | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGAAGGGGGATACACGCACTAAGTTTACGGAGTGAAGTCGTAGCCAGA |
Internal bar code: | GCCGGAAGCGCAAGCCATGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2516 |
LEAP-Seq percent confirming: | 91.3043 |
LEAP-Seq n confirming: | 21 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCAAGACCATCAAGCTCT |
Suggested primer 2: | ACATGATTCCACGCCCATGT |