Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.037871 |
Chromosome: | chromosome 7 |
Location: | 1052749 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g319850 | (1 of 1) PF00571//PF07714 - CBS domain (CBS) // Protein tyrosine kinase (Pkinase_Tyr) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCTCCACCGTCCTCAGCGCCTGCGCTATGGAGGCCCCGATGTTGGCTG |
Internal bar code: | AACGACAGGTGGCGGGGCGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4653 |
LEAP-Seq percent confirming: | 91.3043 |
LEAP-Seq n confirming: | 42 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGACGCAGCCGGTCATATAC |
Suggested primer 2: | AGGATCTCAATCTCGCGCTG |