| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.037875 |
| Chromosome: | chromosome 13 |
| Location: | 4776988 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g604550 | (1 of 8) PF14580 - Leucine-rich repeat (LRR_9) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCGCCTCCGCAGCCGCCTCAGCTGCCAGCGCCCGCACCGCGCTCACG |
| Internal bar code: | AGTACAGCGATGGGGCAGGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 489 |
| LEAP-Seq percent confirming: | 47.1698 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGGACTACAGGTAGGGGT |
| Suggested primer 2: | AGAAGCTTGTGCACGTACGA |