| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.037952 |
| Chromosome: | chromosome 16 |
| Location: | 4973342 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686350 | (1 of 1) IPR000738//IPR009068 - WHEP-TRS domain // S15/NS1, RNA-binding | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGCTTCACCGCGCGCGGCGCGCCCGCCCCTTTACCACCGCCGCCGCC |
| Internal bar code: | CATGAGGAGACCTTTACCGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2159 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCATCCTCCTCCTCTTCA |
| Suggested primer 2: | CTTCACCAACCTGCCTTTGC |