Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.038081 |
Chromosome: | chromosome 2 |
Location: | 5895540 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g117500 | HXK1 | Hexokinase; (1 of 1) K00844 - hexokinase (HK) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTCGACCTCCAGTTCCGCCAACCGCTCCGCGCTGGGGACGAGCTGGTC |
Internal bar code: | TTTTACGGTTAATTAATAACAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1506 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTTATCCAACCCATTGCG |
Suggested primer 2: | CTATGTAGAGCCTGCAGCCC |