Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.038133 |
Chromosome: | chromosome 1 |
Location: | 2562318 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g015103 | Solute-binding protein-like adenylate cyclase; (1 of 7) PF00211//PF13416 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_8) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTGCAACCAATATTTTGACAGAGAAAGCACCACCCATCCGTGCTGTCG |
Internal bar code: | TGGTTTTTATCTCTGGTAAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 789 |
LEAP-Seq percent confirming: | 25.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTCACTGCTTGCTCAGGA |
Suggested primer 2: | TGAACACTGACGCCCATTGA |