Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.038199 |
Chromosome: | chromosome 16 |
Location: | 4055566 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g690350 | SNR6 | SNARE-associated Golgi protein; (1 of 1) PTHR12677:SF24 - TRANSMEMBRANE PROTEIN 64 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTTCCAGGCTGGCACTGGGTGGGCAGTGCGGCGAGGGGAAGTGTATGC |
Internal bar code: | TGCAACTTGTTAAGGAGCTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 252 |
LEAP-Seq percent confirming: | 22.2222 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGAAGCTCGTTCCCTAGGA |
Suggested primer 2: | ACATAGTCTCCGTCCGGTCA |